Text-only / Accessible Version Skip Navigation

Jump to Activity:   

Search the Database:  

A Concord Consortium Project
HomeDatabaseSoftwareReportsAuthoring

Home >> Database >> Activities >> View

In the Database section: Search | Browse



Activity Number
285
Editable
Overview and Learning Objectives
Assessment
Classroom Practice
Central Concepts
Textbook References
Benchmarks and Standards
Additional Info
Activity Credits
Requirements

Designer Proteins

Interactive, scaffolded model

Activity Screenshot

Go To Activity


Follow the link above to start or download this activity.

This Activity Requires:

  • Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

      Test your system to see if it meets the requirements

Important! If you cannot launch anything from this database, please follow the step-by-step instructions on the software page.

Please Note: Many models are linked to directly from within the database. When an activity employs our scripting language, Pedagogica, as do some of the "guided" activities, the initial download may take several minutes. Subsequent activities will not take a long time. See this page for further instructions.

Overview and Learning Objectives

In this activity students design proteins that will perform several fairly simple functions, e.g., trap and carry an ion. They experiment with code for DNA that will translate into proteins with particular characteristics.

Students will be able to:

  • experiment with code for DNA that translate into proteins;
  • specify how coding of protein relates to desired protein sequence;
  • demonstrate how the distribution of charge in a protein is critical to its shape and function.

return to top

Assessment

http://www.concord.org/~barbara/workbench_web/pdf/DesignerProtein_8.07bt.pdf

return to top

Classroom Practice

TTTTTTTTTGATTTTGATTTTGATTTTGATTTTTTTTTT

is a solution for p. 4

A solution for p. 5 is

GATGATGATTTTTTTTTTTTTTTTTTTTTTCATCATCAT

return to top

Central Concepts

Key Concept:

A protein's structure enables it to perform particular functions.

Additional Related Concepts

Molecular Biology

  • Amino acid
  • Gene expression
  • Primary structure
  • Protein
  • Protein Function
  • Protein structure

return to top

Textbook References

  • Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 7 - Nucleic Acids and Protein Synthesis
  • Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 18: Protein Synthesis and Folding in the Cytoplasm
  • Web of Life - Chapter 7: DNA, Genes and Chromosomes
  • Web of Life - Chapter 8: Protein Synthesis

return to top

Benchmarks and Standards

AAAS

  • THE LIVING ENVIRONMENT: CELLS - The work of the cell is carried out by the many different types of molecules it assembles, mostly proteins (Full Text of Standard)

  • THE LIVING ENVIRONMENT: CELLS - Within every cell are specialized parts for the transport of materials, energy transfer, protein building, waste disposal, information feedback, and even movement (Full Text of Standard)

NSES

  • Life Science: Heredity Molecular Basis - 1 In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA (Full Text of Standard)

  • Life Science: The Cell - 1 Cells have particular structures that underlie their functions (Full Text of Standard)

  • Science as Inquiry: 3 Use technology and mathematics to improve investigations and communications (Full Text of Standard)

  • Science as Inquiry: Design and conduct scientific investigations (Full Text of Standard)

return to top

Additional Info

Additional Background

http://pdbdev.sdsc.edu:48346/pdb/molecules/pdb70_1.html

David Goodsell's molecule of the Month

return to top

Activity Credits

Created by CC: Molecular Literacy using Molecular Workbench

return to top

Requirements

  • Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

return to top



Last Update: 08/05/2008 Maintainer: CC Web Team (webmaster@concord.org)
Document Options: Text-only / Accessible Version | Printable Version | E-mail this Page

Copyright © 2008, The Concord Consortium.
All rights reserved.

NSF Logo
These materials are based upon work supported by the
National Science Foundation under grant number DUE-0402553

Any opinions, findings, and conclusions
or recommendations expressed in this material are those of
the author(s) and do not necessarily reflect the views
of the National Science Foundation.