Designer Proteins

Interactive, scaffolded model

Overview and Learning Objectives

In this activity students design proteins that will perform several fairly simple functions, e.g., trap and carry an ion. They experiment with code for DNA that will translate into proteins with particular characteristics.

Students will be able to:

• experiment with code for DNA that translate into proteins;
• specify how coding of protein relates to desired protein sequence;
• demonstrate how the distribution of charge in a protein is critical to its shape and function.

return to top

Assessment

http://www.concord.org/~barbara/workbench_web/pdf/DesignerProtein_8.07bt.pdf

return to top

Classroom Practice

TTTTTTTTTGATTTTGATTTTGATTTTGATTTTTTTTTT

is a solution for p. 4

A solution for p. 5 is

GATGATGATTTTTTTTTTTTTTTTTTTTTTCATCATCAT

return to top

Central Concepts

Key Concept:

A protein's structure enables it to perform particular functions.

Additional Related Concepts

Molecular Biology

• Amino acid
• Gene expression
• Primary structure
• Protein
• Protein Function
• Protein structure

return to top

Textbook References

• Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 7 - Nucleic Acids and Protein Synthesis
• Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 18: Protein Synthesis and Folding in the Cytoplasm
• Web of Life - Chapter 7: DNA, Genes and Chromosomes
• Web of Life - Chapter 8: Protein Synthesis

return to top

Benchmarks and Standards

AAAS

• THE LIVING ENVIRONMENT: CELLS - The work of the cell is carried out by the many different types of molecules it assembles, mostly proteins (Full Text of Standard)
  
  
• THE LIVING ENVIRONMENT: CELLS - Within every cell are specialized parts for the transport of materials, energy transfer, protein building, waste disposal, information feedback, and even movement (Full Text of Standard)
  
  

NSES

• Life Science: Heredity Molecular Basis - 1 In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA (Full Text of Standard)
  
  
• Life Science: The Cell - 1 Cells have particular structures that underlie their functions (Full Text of Standard)
  
  
• Science as Inquiry: 3 Use technology and mathematics to improve investigations and communications (Full Text of Standard)
  
  
• Science as Inquiry: Design and conduct scientific investigations (Full Text of Standard)
  
  

return to top

Additional Info

Additional Background

http://pdbdev.sdsc.edu:48346/pdb/molecules/pdb70_1.html

David Goodsell's molecule of the Month

return to top

Activity Credits

Created by CC: Molecular Literacy using Molecular Workbench

return to top

Requirements

• Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

return to top